View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8510_low_36 (Length: 242)
Name: NF8510_low_36
Description: NF8510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8510_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 37809825 - 37809595
Alignment:
| Q |
1 |
cacaactcaaatttaaagaggaatgaaacaagattgaaaaggaacaaaatactttaaagtaattaatccactgcctagtcattctatgtcaagtctagtc |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37809825 |
cacaactcaaattttaagaggaatgaaacaagattgaaaaggaacaaaatattttaaagtcattaatccactgcctagtcattctatgtcaagtcgagtc |
37809726 |
T |
|
| Q |
101 |
aagcttgacatatgcctggttatttttgaagaactaatgtagaactctactctctttgctgcagggttaaagcccaacacactatatcaatatcaatgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37809725 |
aagcttgacatatgcctggttatttttgaagaactaatgtagaactctactctctttgctgcaggattaaagcccaacacactatatcaatatcaatgtg |
37809626 |
T |
|
| Q |
201 |
gagatccttctttgtcagcaatgagtgatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37809625 |
gagatccttctttgtcagcaatgagtgatgt |
37809595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 37817143 - 37817063
Alignment:
| Q |
151 |
tctctttgctgcagggttaaagcccaacacactatatcaatatcaatgtggagatccttctttgtcagcaatgagtgatgt |
231 |
Q |
| |
|
||||||||||||||| || || |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37817143 |
tctctttgctgcaggtttgaaacccaacacactataccaatatcaatgtggagatccttctttaccagcaatgagtgatgt |
37817063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University