View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8510_low_42 (Length: 212)
Name: NF8510_low_42
Description: NF8510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8510_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 5365922 - 5366103
Alignment:
| Q |
14 |
gagaagaaggcttggagaaaatatgcagctagtttttgttctatgtcaccataaggggagcttagttcgttaagcatccacatgagttgttgtaaacgag |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365922 |
gagaataaggcttggagaaaatatgcagctagtttttgttctatgtcaccataaggggagcttagttcgttaagcatccacatgagttgttgtaaacgag |
5366021 |
T |
|
| Q |
114 |
tgctgnnnnnnnctgctatggctcgtgctgtttcgaggaggatgttgttggcccactttccggttaattcgaaggtgaaatc |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5366022 |
tgctgtttttttctgctatggctcgtgctgtttcgaggaggatgttgttggcccaccttccggttaattcgaaggtgaaatc |
5366103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 105
Target Start/End: Complemental strand, 39987382 - 39987321
Alignment:
| Q |
44 |
agtttttgttctatgtcaccataaggggagcttagttcgttaagcatccacatgagttgttg |
105 |
Q |
| |
|
|||||||| ||| |||||||||| |||| || || ||||| |||||||||||||||||||| |
|
|
| T |
39987382 |
agtttttgatctgtgtcaccatatggggtactaagctcgtttagcatccacatgagttgttg |
39987321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University