View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_high_28 (Length: 255)
Name: NF8511_high_28
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 13 - 202
Target Start/End: Original strand, 25700613 - 25700802
Alignment:
| Q |
13 |
atgaataagaaggcacctctatctggaaaagtaatacatgtcacccacagttggagaatgagtctattctagacctggttgtatcatattccttcctcaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25700613 |
atgaataagaaggcacctctatctgggaaagtaatacatgtcacccacagttggagaatgagtctattctagacctggttgtatcatattccttcctcaa |
25700712 |
T |
|
| Q |
113 |
ctcttctctcacacaaatgtgtcaatcnnnnnnncggtcctcttgcgattgtcatctgccactgcttctttagactacctagtcgtcgcc |
202 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||| ||||| ||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
25700713 |
ctcttctctcacacaaatgcgtcaatctttttttcggtcctcctgcgactgtcatctgccaccgcttctttagactacctagtggtcgcc |
25700802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 185 - 255
Target Start/End: Original strand, 25700822 - 25700892
Alignment:
| Q |
185 |
gactacctagtcgtcgccactctacaccacttcttccaattacatcccttgttttatcgatgatttaattc |
255 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25700822 |
gactacctagtcgtcgccgctctacaccacttcttccaattacatcccttgttttatcgatgatttaattc |
25700892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University