View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_high_39 (Length: 234)
Name: NF8511_high_39
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 34 - 209
Target Start/End: Original strand, 44540650 - 44540828
Alignment:
| Q |
34 |
taaaatgctcggactaaagaggatagggatagcagacaagcatttcgacttcttactttcccttttttacttgtaaaacgttccatttattcttttatat |
133 |
Q |
| |
|
|||| ||||||| ||| |||||||||| |||||||| |||||| || ||||| |||| |||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
44540650 |
taaagtgctcggtataatgaggatagggttagcagacgagcattctgaattctttcttttccttttttacttgtaaaaagttccatttcttcttttatat |
44540749 |
T |
 |
| Q |
134 |
acataattttagtttattgaaatgcagattctggg---atatttgcctccattatcttaatccggttgtattgcctaac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44540750 |
acataattttagtttattgaaatgcagattctgggaatatatttgcctccattatcttaatccggttgtattgcctaac |
44540828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University