View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_high_41 (Length: 213)
Name: NF8511_high_41
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 30171198 - 30171394
Alignment:
| Q |
1 |
ttgtctgctttgctttctctgctatgttttgtgttgccgctgatgccttattaactgcgtcttttgtttggttagcaacctgattaattcaatacaacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30171198 |
ttgtctgctttgctttctctgctatgttttgtgttgccgctgatgccttattagctgcgtcttttgtttggttagcaacctgattaattcaatacaacta |
30171297 |
T |
 |
| Q |
101 |
agcaattaattattaatttcattgtactatagtatcacctagaagaaaatgtgatcacataattaataatatggtcatgagttacattacatggtgtcca |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30171298 |
agcaatta---attaatttcattgtactatagtatcacctagaagaaaatgtgatcacataattaataatatggtcatgagttacattacatggtgtcca |
30171394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University