View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_100 (Length: 237)
Name: NF8511_low_100
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_100 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 36000250 - 36000465
Alignment:
| Q |
2 |
aactcggatgtttatgtcaaatgttataacatcaattagtcattactagagttcttacatgaccattgacatacttgaaaagtga---nnnnnnnnacac |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
36000250 |
aactcggatgtttatgtcaaatgttataacatcaattagtcattactagagttcttacatgaccattgacttacttgaaaagtgatttttttttttacac |
36000349 |
T |
|
| Q |
99 |
aaacaattattacttttaggccttataaacattttcttttactttgatatgctgatatgcatactcagcatcaagaacccttgttgaaatgtacttcgta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||| ||| |
|
|
| T |
36000350 |
aaacaattattacttttaggccttataaacattttcttttactt--------tgatatgcatactcaacatcaagaacccttgttgaaatctactttgta |
36000441 |
T |
|
| Q |
199 |
aacagttacaatgcatgtgggata |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36000442 |
aacagttacaatgcatgtgggata |
36000465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University