View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_101 (Length: 235)
Name: NF8511_low_101
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_101 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 36 - 152
Target Start/End: Original strand, 13112666 - 13112782
Alignment:
| Q |
36 |
cagaacctgtgttattttgaaggagatggaaactaattggttgaacatgtgagaagagcaaactaagatttgaaagaagagaatattggaagaagaaccg |
135 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13112666 |
cagaccctgtgttattttgaaggagatggaaactaattggttgaacatgtgagaagagcaaactaagatttgaaagaagagaatattggaagaagaaccg |
13112765 |
T |
|
| Q |
136 |
gaaattgcagtgagaaa |
152 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
13112766 |
gaaattgcggtgagaaa |
13112782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 13112836 - 13112891
Alignment:
| Q |
147 |
gagaaagatttggtcgaaaaagaaaggaataaatcaactgaattggtacaacaatt |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13112836 |
gagaaagagttggtcgaaaaagaaaggaataaatcaactgaattggtgcaacaatt |
13112891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University