View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_103 (Length: 232)
Name: NF8511_low_103
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 32959904 - 32959729
Alignment:
| Q |
8 |
gagtgagaagaaggagaaaaaatatgatagaaatgtacttacaatcttgcatgaaccaagttgaagaagaccatgtccagcttgaattacagctatggtc |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959904 |
gagtgaaaagaaggagaaaaaatatgatagaaatgtacttacaatcttgcatgaaccaagttgaagaagaccatgtccagcttgaattacagctatggtc |
32959805 |
T |
|
| Q |
108 |
tgctcatggaaacaaataaaatgagttgaaaaatcttaagaaatcaattaatccttgtgagaccaataataatagc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959804 |
tgctcatggaaacaaataaaatgagttgaaaaatcttaagaaatcaattaatccttgtgagaccaataataatagc |
32959729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University