View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_107 (Length: 221)
Name: NF8511_low_107
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_107 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 203
Target Start/End: Original strand, 48890802 - 48891002
Alignment:
| Q |
16 |
aagaaaagagagcaagaaacaaggattattgtggtcttattttatgtgtatacctataaatttacttaacatgtctgtta-------------ggttgca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
48890802 |
aagaaaagagagcaagaaacaaggattattgtggtcttattttatgtgtatacctataaattaacttaacatgtctgttatctgcaacttgtgggttgca |
48890901 |
T |
 |
| Q |
103 |
aaccttgcacattcagttcagatcggatagtttcacttctttacactttagcatgaggttttaagggtttgatttccttataggattttagagctcgttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48890902 |
aaccttgcacattcagttcagatcggatagtttcacttctttacactttagcatgaggttttaagggtttgatttccttatagggttttagagctcgttt |
48891001 |
T |
 |
| Q |
203 |
g |
203 |
Q |
| |
|
| |
|
|
| T |
48891002 |
g |
48891002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University