View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_109 (Length: 219)
Name: NF8511_low_109
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_109 |
 | |
|
| [»] scaffold0386 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 6068247 - 6068446
Alignment:
| Q |
1 |
attccatgttagtgatctctacgcctcgaagaggattttgtctctcgctcgctaccactgtcttagaagttcttttccagtgattcatggttcccctaga |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068247 |
attccatgttagtgttctctacgcctcgaagaggattttgtctctcgctcgctaccactgtcttagaagttcttttccagtgattcatggttcccctaga |
6068346 |
T |
|
| Q |
101 |
agtgatataatcataagaatgtgcaaatagctaccggtcggcaatatatagaacacatattttctttaatcttagtcgaatgcgtgtcatgtcttctaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
6068347 |
agtgatataatcataagaatgtgcaaatagttactggtcggcaatatatagaacacatattttctttaatcttagtcgaatgcatgtcccgtcttctaaa |
6068446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 15653 - 15693
Alignment:
| Q |
1 |
attccatgttagtgatctctacgcctcgaagaggattttgt |
41 |
Q |
| |
|
||||||||||||||||||||| |||| || ||||||||||| |
|
|
| T |
15653 |
attccatgttagtgatctctaagcctagaggaggattttgt |
15693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University