View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_114 (Length: 206)
Name: NF8511_low_114
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_114 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 8960668 - 8960530
Alignment:
| Q |
1 |
gcagaaggcaattaagaagagttaatgaatgtgttggatgaagtacattcagtgttggaacagtaaacatccattctgtgttaaatacgacttgtgat-- |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8960668 |
gcagaaggcaattaagaagagttaatgaatgtgttggatgaagtatattcagtgttggaacagtaaacatccattctgtgttaaatacgacttgtgatag |
8960569 |
T |
|
| Q |
99 |
--cttgcacatgttaacattgccacgtggtattcatctt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8960568 |
aggttgcacatgttaacattgccacgtggtatccatctt |
8960530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 162 - 195
Target Start/End: Complemental strand, 8960525 - 8960492
Alignment:
| Q |
162 |
tggtattctaagttcttaaagttcttcttctcac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8960525 |
tggtattctaagttcttaaagttcttcttctcac |
8960492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University