View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_115 (Length: 205)
Name: NF8511_low_115
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_115 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 31945034 - 31945204
Alignment:
| Q |
16 |
gaacaatgaatcttttcaaggcaattctaaaaacttagatggttttgatgcattttcacaacttggtttagctccaatattgacaaagcaagtgaaattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
31945034 |
gaacaatgaatcttttcaaggcaattctaaaaacttagatggttttgatgcattttcacaacttggtttagctccaatattaacaaagcaagtcaaattt |
31945133 |
T |
|
| Q |
116 |
gaagaaaagattgccaaggtgaccgaatcgcgaagttcaactgaatcagacgagcgaaaaatcgatcattc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31945134 |
gaagaaaagattgccaaggtgaccgaatcgcgaagttcaactgaatcagacgagcgaaaaatcgatcattc |
31945204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University