View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8511_low_117 (Length: 203)

Name: NF8511_low_117
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8511_low_117
NF8511_low_117
[»] chr1 (1 HSPs)
chr1 (42-188)||(49905043-49905189)


Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 42 - 188
Target Start/End: Complemental strand, 49905189 - 49905043
Alignment:
42 aatactcataacatcatttactcttgcagagtggggggccaaagctcttttctgttttaggggtcccctgcatttttaagggagaatatgttcttttcat 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49905189 aatactcataacatcatttactcttgcagagtggggggccaaagctcttttctgttttaggggtcccctgcatttttaagggagaatatgttcttttcat 49905090  T
142 tttggctttcaattccctattttgatgaataccagtctattcttctc 188  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    
49905089 tttggctttcaattccctattttgatgaataccaatctattcttctc 49905043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University