View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_20 (Length: 456)
Name: NF8511_low_20
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-100; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 240 - 437
Target Start/End: Original strand, 36301498 - 36301694
Alignment:
| Q |
240 |
gacatgggtagataggctaatcgggtcctctgtctcagtcaatccttctcccatctttctctctctgaccctttctttgtcatagcttcctccttcaatc |
339 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36301498 |
gacatgggtagctag-ctaatcgggtcctctgtctcagtcaatccttctcccatctttctctctctgaccctttctttgtcatagcttcctccttcaatc |
36301596 |
T |
|
| Q |
340 |
tgacgtcgtttcattccgttacgacttttccaaatctgaatgaaatgcacgctccgaaatcaaccatggcgtctcccgaatccaacggttcagatcac |
437 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36301597 |
tgacgtcgtttcattccgttacgacttttccaaatctgaatgaaatgcacgctccgaaatcaaccatggcgtctcccgaatccaacggttcagatcac |
36301694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 36301280 - 36301324
Alignment:
| Q |
25 |
tttcgataaattagattaagtt-actataacttgttaatcatgtg |
68 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36301280 |
tttcgataaattagattaagttaactataacttgttaatcatgtg |
36301324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 189 - 217
Target Start/End: Original strand, 36301448 - 36301476
Alignment:
| Q |
189 |
gtaatttcgattttcaatgattgtgtaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36301448 |
gtaatttcgattttcaatgattgtgtaag |
36301476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University