View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_37 (Length: 383)
Name: NF8511_low_37
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 4e-51; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 58 - 213
Target Start/End: Original strand, 4702696 - 4702852
Alignment:
| Q |
58 |
atttgcattgtttagtgaaaca--gtggaatagcaagatgtcagaggctgattctgccatatgcaaaaagaaaaggaaatctgagtggtcaagtatgcct |
155 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4702696 |
atttgcattgtttagtgcaacaaagcggaatagcaagatgtcagaggctgattctgccatatgcaaaaagaaaaggaatggagagtggtcaaatatgcct |
4702795 |
T |
 |
| Q |
156 |
tatgatctgctctcaaatattgcaaatatgctagaactgattgatttttaccagtttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
4702796 |
tatgatctgctctcaaatattgcaaataggctggaactgattga-ttttaccagtttt |
4702852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 58 - 216
Target Start/End: Original strand, 4706069 - 4706222
Alignment:
| Q |
58 |
atttgcattgtttagtgaaaca--gtggaatagcaagatgtcagaggctgattctgccatatgcaaaaagaaaaggaaatctgagtggtcaagtatgcct |
155 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||| ||||||||| |||| |||||||||||| ||||||| |||| ||| ||||||||| || | || |
|
|
| T |
4706069 |
atttacattgtttagttaaacaaagtggaataccaagatgtcggaggttgattctgccatctgcaaaatgaaa--gaa----gagtggtcatgtgtaact |
4706162 |
T |
 |
| Q |
156 |
tatgatctgctctcaaatattgcaaatatgctagaactgattgatttttaccagttttcat |
216 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||| ||||||| |||||||| |
|
|
| T |
4706163 |
tatgatctgctgtcaaatattgcaaataggctggaactgattga-ttttacctgttttcat |
4706222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 241 - 293
Target Start/End: Original strand, 4706506 - 4706558
Alignment:
| Q |
241 |
atgactgtattgcagcattttcatctgctcctacatctcaggattgcattgtt |
293 |
Q |
| |
|
|||||| |||||||||| ||||||||||||| |||||||||||||| |||||| |
|
|
| T |
4706506 |
atgactatattgcagcaatttcatctgctcccacatctcaggattgtattgtt |
4706558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University