View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_38 (Length: 381)
Name: NF8511_low_38
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 269 - 347
Target Start/End: Complemental strand, 6285093 - 6285015
Alignment:
| Q |
269 |
ttgtctctattttttgaatagtaataaataaattagtgacatgtttgtctatctctaatgtagtccataattctatgtt |
347 |
Q |
| |
|
||||||| ||||||| | |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6285093 |
ttgtctcaattttttcagtagtaataaataaattagtgacatttttatctatctctaatgtagtccataattctatgtt |
6285015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University