View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_47 (Length: 360)
Name: NF8511_low_47
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 43407146 - 43406951
Alignment:
| Q |
19 |
gataggtatattattcttgccgttgaattcaattaatagttggcagggtacaaaatcatactagtaactttgggatctctgtctccctaactacctatta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407146 |
gataggtatattattcttgccgttgaattcaattaatagttggcagggtacaaaatcatactagtaactttgggatctctgtctccctaactacctatta |
43407047 |
T |
|
| Q |
119 |
cttcctttcacatttaaatataatatcaaattgaaaaaactttgtaaaattatatttgttgataatttatattagtttatgttctcatcatagcta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407046 |
cttcctttcacatttaaatataatatcaaattgaaaaaactttgtaaaattaaatttgttgataatttatattagtttatgttctcatcatagcta |
43406951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 216 - 344
Target Start/End: Complemental strand, 43406902 - 43406774
Alignment:
| Q |
216 |
tgattaaaaaagtaattgtgttcaaaattaaaaacaaatcatatgcaaaatcactttttgaataagtaatcaaatnnnnnnngaagctcttttgaattta |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43406902 |
tgattaaaaaagtaattgtgttcaaaattaaaaacaaatcatatgcaaaatcactttttgaataagtaatcaaataaaaaaataagctcttttgaattta |
43406803 |
T |
|
| Q |
316 |
attacgatgttgaacaatcgataaataag |
344 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43406802 |
attacgatgttgaacaatcgataaataag |
43406774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University