View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_58 (Length: 331)
Name: NF8511_low_58
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 156 - 325
Target Start/End: Original strand, 4156404 - 4156573
Alignment:
| Q |
156 |
gcataagctttctccagcatttcaagctgaaaaggggttttcatctgtctcttaggtttgctttgaccttcacttgaactcacaatcttgttgttacttc |
255 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4156404 |
gcataagctttctcaagcatttcaagctgaaaaggggttttcatctgtctcttaggtttgctttgaccttcacttgaactcacaatcttgttgttacttc |
4156503 |
T |
 |
| Q |
256 |
cattgttgttgaaattttcattactattttcacccccatcatcacccttctgggaattattctctgcttc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4156504 |
cattgttgttgaaattttcattactattttcacccccatcatcacccttctgggaattattctctgcttc |
4156573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University