View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_75 (Length: 272)
Name: NF8511_low_75
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_75 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 32 - 186
Target Start/End: Complemental strand, 3837402 - 3837248
Alignment:
| Q |
32 |
ataattctcgtgatccccccatagtatatatttttgttgctgatgaattgtttttgccctaggacacaagttcaaatattctttgaatcattgaataaat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3837402 |
ataattctcgtgatccccccatagtatatatttttgttgttggtgaattgtttttgccctaggacacaagttcaaatattctttgaatcattgaagaaat |
3837303 |
T |
 |
| Q |
132 |
attcgagatatggttcttgtatggcaataaaatagttgttgactagaattcgtag |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3837302 |
attcgagatatggttcttgtatggcaataaaatagttgttgactagaattcgtag |
3837248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University