View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_78 (Length: 270)
Name: NF8511_low_78
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_78 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 260
Target Start/End: Complemental strand, 35341170 - 35340929
Alignment:
| Q |
19 |
gaaaataccttatgtccataaaagtgacactgattgacaaatacaaacatcttgagaattggaattcaagtgattccacaccatgtggttggaaaggtgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35341170 |
gaaaataccttatgtccataaaagtgacactggttgacaaatacaatcatcttgtgaattggaattcaattgattccacaccatgtggttggaaaggtgt |
35341071 |
T |
|
| Q |
119 |
catctgcaacagtgacatcaatccaatggtggagtctcttgacttgcatgcaatgaatctctcaggctcattgtcttccagcattggtggtttggttcac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35341070 |
catctgcaacagtgacatcaatccaatggtggagtctcttgacttgcatgcaatgaatctctcaggctcattgtcttccagcattggtggtttggttcac |
35340971 |
T |
|
| Q |
219 |
ttgcttcaccttaatctgtctcaaaacactttctctgcttct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35340970 |
ttgcttcaccttaatctgtctcaaaacactttctctggttct |
35340929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University