View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_82 (Length: 260)
Name: NF8511_low_82
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 23394710 - 23394930
Alignment:
| Q |
1 |
agatcaaagaagatattttctttcatttctcaaaatagtagtttcgggctagccaaagaaagaggtcatccgttaaatattttgatttcaatagaattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23394710 |
agatcaaagaagatattttctttcatttcccaaaatagtagtttcgggctagccaaagaaagaggtcatccgttaaatattttaatttcaatagaattca |
23394809 |
T |
 |
| Q |
101 |
agaagttgagaccgaagacttaacaaggggtctctccgaagaggaaattaagcaagttacttagg-cctgatggtgactttcggttttttaaagaacttt |
199 |
Q |
| |
|
| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23394810 |
aaaagttgagactgaagacttaataaggggtctctccgaagaggaaattaagcaagttacttaggccctgatggtgactttcggttttttaaagaacttc |
23394909 |
T |
 |
| Q |
200 |
cgggaatacttaataggtgag |
220 |
Q |
| |
|
| |||| ||||||| |||||| |
|
|
| T |
23394910 |
caggaaaacttaatgggtgag |
23394930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University