View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_85 (Length: 253)
Name: NF8511_low_85
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_85 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 10630226 - 10630042
Alignment:
| Q |
1 |
gaggaaagagtattctatattgagtatcaatcaaatgcatttcact-------tcactacttcattcactatttatacatcatacgatatagttgtatct |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10630226 |
gaggaaagagtattctatattgagtatcaatcaaatgcatttcactacttcattcacattctcattcactatttatacatcatatgatatagttgtatct |
10630127 |
T |
|
| Q |
94 |
ctcaacaaaatgctaaataactaac--tnnnnnnnngttatagaatatactttgacttgtatcccaagtaatttcttattatttt |
176 |
Q |
| |
|
|||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10630126 |
ctcaacaaaatggtaaataactaactgtaaaaaaaagttatagaatatactttgacttgtatcccaagtaatttcttattatttt |
10630042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University