View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8511_low_98 (Length: 238)
Name: NF8511_low_98
Description: NF8511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8511_low_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 54 - 220
Target Start/End: Complemental strand, 19178093 - 19177927
Alignment:
| Q |
54 |
catttacaggcttcgtatccacactgatcttgaatcgatgcaactcaaattgcttcattgcctagcatttcattttctgttgcaacatcttgctggaagg |
153 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19178093 |
catttccaggcttcttatccactctgatcttgaatcgatgcaactcaaattgcttcattgcttagcatttcattttctgttgcaacatcttgctggaagg |
19177994 |
T |
 |
| Q |
154 |
agttacaatgactatgttcctcattctcatcaaatggctctatataaaattcaggtgatgattctac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19177993 |
agttacaatgactatgttcctcattctcatcaaatggctctatataaaattcaggtgatgattctac |
19177927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 98 - 220
Target Start/End: Complemental strand, 27037710 - 27037588
Alignment:
| Q |
98 |
tcaaattgcttcattgcctagcatttcattttctgttgcaacatcttgctggaaggagttacaatgactatgttcctcattctcatcaaatggctctata |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||| |||||| |||||||||||| |||||||| ||||||||| |
|
|
| T |
27037710 |
tcaaattgcttcattgcttagcatttcattttcagttgcaacatcttgctggcaggagttcaaatgaccatgttcctcattttcatcaaaaggctctata |
27037611 |
T |
 |
| Q |
198 |
taaaattcaggtgatgattctac |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27037610 |
taaaattcaggtgatgattctac |
27037588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University