View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8513_high_3 (Length: 273)
Name: NF8513_high_3
Description: NF8513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8513_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 114130 - 113910
Alignment:
| Q |
1 |
atataaccaggtctagttgttgtgaccggtcacccccaatttacaaacaa-ttttttctttatttattgaaacaagattctgttttgtttcttgtgttct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
114130 |
atataaccaggtctagttgttgtgaccggtcacccccaatttacaaacaagttttttctttatttattgaaacaagattctgttttgtttcttgtgttct |
114031 |
T |
|
| Q |
100 |
tgaataatgaatgacattaattaagattaggatgagggagagaatgaatccgaaaatgacgtaggaagagcgtgttttgcgtagctatatatgggaggct |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
114030 |
tgaataatgaatgacattaa----gattaggatgagggagagaatgaatccgaaaatgacgtaggaagagcgtgttttgcgtagc----tatgcgaggct |
113939 |
T |
|
| Q |
200 |
ttaaaaaggtcatgttatgttcacatgtt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
113938 |
ttaaaaaggtcatgttatgttcacatgtt |
113910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 228 - 258
Target Start/End: Complemental strand, 113894 - 113864
Alignment:
| Q |
228 |
tagttacacttacttatcaatagtaaaaaat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
113894 |
tagttacacttacttatcaatagtaaaaaat |
113864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University