View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8513_high_4 (Length: 239)
Name: NF8513_high_4
Description: NF8513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8513_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 77 - 223
Target Start/End: Complemental strand, 17523305 - 17523161
Alignment:
| Q |
77 |
tttatggaactcaagttacttactataagttggtgataatttctaattcaagtctgaattgaagatagaacaagattagggatgatagttcatagaattt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||| | |||| || ||| |
|
|
| T |
17523305 |
tttatggaactcaagttacttactataagttggtgataatttataattcaagtctgaattgaagatagaacaagatga-ggatgatggatcatcgagttt |
17523207 |
T |
|
| Q |
177 |
ttattcagaactaagtagaaagcagcacaagcaaatgtagtatcata |
223 |
Q |
| |
|
| ||||| ||| |||||||||||| |||||| || ||||| |||||| |
|
|
| T |
17523206 |
taattca-aacgaagtagaaagcatcacaagtaattgtagcatcata |
17523161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 17524279 - 17524201
Alignment:
| Q |
1 |
aagtaatttagggattaacaaaattagttaagtgcaannnnnnnnnnatacatgttactaaagtatcttgttgatattta |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
17524279 |
aagtaatttagggattaacaaaattagttaagtgcaa-attttttttatgcatgttactaaagtatcttgttgatattta |
17524201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University