View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8513_low_6 (Length: 239)

Name: NF8513_low_6
Description: NF8513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8513_low_6
NF8513_low_6
[»] chr8 (2 HSPs)
chr8 (77-223)||(17523161-17523305)
chr8 (1-80)||(17524201-17524279)


Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 77 - 223
Target Start/End: Complemental strand, 17523305 - 17523161
Alignment:
77 tttatggaactcaagttacttactataagttggtgataatttctaattcaagtctgaattgaagatagaacaagattagggatgatagttcatagaattt 176  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||| | |||| || |||    
17523305 tttatggaactcaagttacttactataagttggtgataatttataattcaagtctgaattgaagatagaacaagatga-ggatgatggatcatcgagttt 17523207  T
177 ttattcagaactaagtagaaagcagcacaagcaaatgtagtatcata 223  Q
    | ||||| ||| |||||||||||| |||||| || ||||| ||||||    
17523206 taattca-aacgaagtagaaagcatcacaagtaattgtagcatcata 17523161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 17524279 - 17524201
Alignment:
1 aagtaatttagggattaacaaaattagttaagtgcaannnnnnnnnnatacatgttactaaagtatcttgttgatattta 80  Q
    |||||||||||||||||||||||||||||||||||||          || ||||||||||||||||||||||||||||||    
17524279 aagtaatttagggattaacaaaattagttaagtgcaa-attttttttatgcatgttactaaagtatcttgttgatattta 17524201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University