View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8516_high_28 (Length: 212)
Name: NF8516_high_28
Description: NF8516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8516_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 49105032 - 49104842
Alignment:
| Q |
1 |
tttttatattaaaacttgtttcttagtttcgtttcactatttatttgaagtctgcaaatacaagaaaaagtagaagtgaactgtaaacttctaggccatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49105032 |
tttttatattaaaacttgtttcttagtttcgtttcactatttatttgaagtctgcaaatacaagaaaaagtagaagtgaactgtaaacttctaggccatg |
49104933 |
T |
 |
| Q |
101 |
agccatcatcgtgtctagattaattaacaatgacttatatgcatggagtaataatgttggacgattatggctgaaggtgatattcaaattt |
191 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49104932 |
agccatcatcgtggctagattaattaacaatgacttatatgcatggagtaataatgttggacgattatgactgaaggtgatattcaaattt |
49104842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University