View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8516_high_29 (Length: 207)
Name: NF8516_high_29
Description: NF8516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8516_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 54 - 188
Target Start/End: Complemental strand, 36463490 - 36463350
Alignment:
| Q |
54 |
aatcatgagcaagtaggcagatgattgttttaaattagcaagataaatatagagcattgtgatatatgcgagagatga------tgattaagattgtttt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
36463490 |
aatcatgagcaagtaggcagatgattgttttaaattaggaagacaaatatagagcattgtgatatctgcgagagatgatgatgatgattaagattgtttt |
36463391 |
T |
 |
| Q |
148 |
gttatggcaaggaggaattggtgtcatatgaatcttgaggc |
188 |
Q |
| |
|
||| ||||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
36463390 |
gttgtggcaaggaagaattgttgtcatatgaatcttaaggc |
36463350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University