View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8516_high_9 (Length: 359)
Name: NF8516_high_9
Description: NF8516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8516_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 6e-65; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 6384043 - 6384176
Alignment:
| Q |
1 |
ccaagtacaacgaagcatataaagaccaaataacttggagaaattttgtctcaagttcatatcaatgatgaaaagtacatgaaaaatgaagagaacaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6384043 |
ccaagtacaacgaagcatataaagaccaaataacttggagaaattttgtcccaagttcatatcaatgatgaaaaatacatgaaaaatgaagagaacaagg |
6384142 |
T |
|
| Q |
101 |
agaaaaattctctcgtccatgcatcccacgcatg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6384143 |
agaaaaattctctcgtccatgcatcccacgcatg |
6384176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 90
Target Start/End: Original strand, 23736922 - 23736985
Alignment:
| Q |
27 |
caaataacttggagaaattttgtctcaagttcatatcaatgatgaaaagtacatgaaaaatgaa |
90 |
Q |
| |
|
|||| ||||||||||| | |||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23736922 |
caaacaacttggagaatatatgtcccaagttcatatcaaagatgaaaagcacatgaaaaatgaa |
23736985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 241 - 348
Target Start/End: Original strand, 6379130 - 6379239
Alignment:
| Q |
241 |
attcaaaatcatgacagctcggaggctaaggagtgtgaccaaagcaaccaaaataggt-tttttctaacccctttcgcttgttattgtgtatgcaca-tt |
338 |
Q |
| |
|
||||| ||||||||| ||| |||||||| |||||||| | ||||||||||| ||| |||||| ||||||||| ||||||||||||||| ||| || |
|
|
| T |
6379130 |
attcagaatcatgacgactcataggctaagaagtgtgactagagcaaccaaaaggggtgtttttcaaacccctttaacttgttattgtgtatatacactt |
6379229 |
T |
|
| Q |
339 |
ttatttctct |
348 |
Q |
| |
|
|||||||||| |
|
|
| T |
6379230 |
ttatttctct |
6379239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University