View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8516_low_10 (Length: 387)
Name: NF8516_low_10
Description: NF8516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8516_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 22 - 306
Target Start/End: Complemental strand, 28240940 - 28240656
Alignment:
| Q |
22 |
caggaagaagtcaaacggatccaatctgttccgcttgtgatcggtcagtttatggagatggttgataccaataacgggattgttggatctacgactgggt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28240940 |
caggaagaagtcaaacggatccaatctgttccgcttgtgatcggtcagtttatggagatggttgataccaataacgggattgttggatctacgactgggt |
28240841 |
T |
 |
| Q |
122 |
cgaattactatgttaggattttgagtacgattaatcgggagcttttgaagccgtcggcttcggttgcacttcatcgtcattcgaatgcgcttgttgatgt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28240840 |
cgaattactatgttaggattttgagtacgattaatcgggagcttttgaaaccttcggcttcggttgcacttcatcgtcattcgaatgcgcttgttgatgt |
28240741 |
T |
 |
| Q |
222 |
tcttccaccggaagctgattcaagtatctcacttcttagtcagtctgagaagcctgatgttacttataatgttagtatgtttatg |
306 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28240740 |
tcttccaccggaagctgattccagtatctcgcttcttagtcagtctgagaagcctgatgttacttataatgttagtatgtttatg |
28240656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 184 - 297
Target Start/End: Complemental strand, 45990062 - 45989949
Alignment:
| Q |
184 |
gttgcacttcatcgtcattcgaatgcgcttgttgatgttcttccaccggaagctgattcaagtatctcacttcttagtcagtctgagaagcctgatgtta |
283 |
Q |
| |
|
||||| ||||| || ||||| ||||| ||||||||||||||||| || || | |||||| ||||||| ||| ||||||||||||||||||||||||| | |
|
|
| T |
45990062 |
gttgcgcttcaccgacattccaatgctcttgttgatgttcttcctcctgaggttgattctagtatcttgctttttagtcagtctgagaagcctgatgtca |
45989963 |
T |
 |
| Q |
284 |
cttataatgttagt |
297 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
45989962 |
cttataatcttagt |
45989949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University