View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8516_low_17 (Length: 336)
Name: NF8516_low_17
Description: NF8516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8516_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 313
Target Start/End: Original strand, 25968727 - 25969021
Alignment:
| Q |
19 |
gtctccacgatcacctcagttgatggatatagtgtcggagttgttagaatcatcggcgtcatcgcacaaggtgagactagggaagctatcccgccagact |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25968727 |
gtctccacgatcacctcagttgtaggatatagtgtcggagttgttagaatcgtcggcgtcatcgcacaaggtgagaccagggaagctatcccgccagact |
25968826 |
T |
 |
| Q |
119 |
tcttcgcacggattatgaacgatgtcgtgttgtggggcgtaaacggggcagagatacttttggtgtcggtaaacctcctcttagagtaattaaactggcg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25968827 |
tcttcgcacggattatgaacgatgtcgtgttgtggggtgtaaacggggcagagatacttttggtgtcggtaaacctcctcttagagtagttaaactggcg |
25968926 |
T |
 |
| Q |
219 |
aaaatttcttgtgaatcggttgatcttcaatgaatctttccgattttcaaatgtgtctgcattgttgttgcgtctcttgggtatgtctctgctcc |
313 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25968927 |
aaaatttcttgtgaatcggttggtcttcaatgaatctttccgattttcaaatgtatctgcattgttgttgcgtctcttgggtatgtttctgctcc |
25969021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University