View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8516_low_36 (Length: 214)
Name: NF8516_low_36
Description: NF8516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8516_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 12 - 198
Target Start/End: Complemental strand, 35834969 - 35834783
Alignment:
| Q |
12 |
tttggtgtttatgtgaaaccatcggtaactttcttattttatctcttttttgtaatgtgttgatctaatatgagtaatgctactgagaaaattatttaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| || ||||||||||||||||| |
|
|
| T |
35834969 |
tttggtgtttatgtgaaaccatcggtaactttcttattttatctcttttttgtaatgtgttgatttaatatgagaaatggtattgagaaaattatttaat |
35834870 |
T |
 |
| Q |
112 |
tgaatgtaatcacatttgttagtgtcagatagtgcagacactagatatgcattttataagatgtgttggtgctatagaggttatatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35834869 |
tgaatgtaatcacatttgttagtgtcagatagtgcagacactagatatgcattttataagatgtgttggtgctatagaggttatatt |
35834783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 95 - 136
Target Start/End: Complemental strand, 6252536 - 6252495
Alignment:
| Q |
95 |
tgagaaaattatttaattgaatgtaatcacatttgttagtgt |
136 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6252536 |
tgagaaaataatttaattaaatgtaatcacatttgttagtgt |
6252495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University