View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8516_low_6 (Length: 482)
Name: NF8516_low_6
Description: NF8516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8516_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 23 - 474
Target Start/End: Complemental strand, 38612563 - 38612106
Alignment:
| Q |
23 |
cctcctccatgggttctggttcaggttcaggttcaggttccggcgctggtgcttgcgcttg------agcttcaacgtcgcctccagactttcggaagat |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38612563 |
cctcctccatgggttctggttctggttcaggttcaggttccggcgctggtgcttgcgcttgcgcttgagcttcaacgtcgcctccagactttcggaagat |
38612464 |
T |
 |
| Q |
117 |
ctgatcgatgcggcgagtaccaaccggaacggatttaggccgatccacaaccgccgctggtttatcagatttcacagtttcagacggcaccggaagcgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612463 |
ctgatcgatgcggcgagtaccaaccgaaacggatttaggccgatccacaaccgccgctggtttatcagatttcacagtttcagacggcaccggaagcgaa |
38612364 |
T |
 |
| Q |
217 |
tcgagtagaaaatcacttattggacggtttctcttcaccgcgattctcatatgttcaagcttcaccgtcttgcgcttcttctcaatagcaacttccgcag |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612363 |
tcgagtagaaaatcacttattggacggtttctcttcaccgcgattctcatatgttcaagcttcaccgtcttgcgcttcttctcaatagcaacttccgcag |
38612264 |
T |
 |
| Q |
317 |
acttttcagcaagtaactgtnnnnnnngctccgtagaccgtgacaccaagaacaacgcttctgaactcaccctcttcacgtctttgtccagagtgattat |
416 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612263 |
acttttcagcaagtaactgtaaaaaaagctccgtagaccgtgacaccaagaacaaagcttctgaactcaccctcttcacgtctttgtccagagtgattat |
38612164 |
T |
 |
| Q |
417 |
cttcttcactctactcttcggaaactctggttcagacgacagcgttttctctgcttct |
474 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
38612163 |
cttcttcactctactcttcggaaactctggttcaaacgacagcgttttctcttcttct |
38612106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University