View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8516_low_9 (Length: 394)
Name: NF8516_low_9
Description: NF8516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8516_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 9 - 325
Target Start/End: Original strand, 35679909 - 35680225
Alignment:
| Q |
9 |
agcagagattggaacaggttagtcagaatccaatctttgtcttgttttgtgaatcaaagtcaaacacctttcttatctttattagaatctttcaggtcca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35679909 |
agcagagattggaacaggttagtcagaatccaatctttgtcttgttttgtgaatcaaagtcatacacctttcttatctttattagaatctttcaggtcca |
35680008 |
T |
 |
| Q |
109 |
aacgtggtcgtattcctccacggtttcccagagatatggtactcctggcgccaccagatgttagctctcgccggtgccggtttcagagctatagctcctg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35680009 |
aacgtggtcgtattcctccacggtttcccagagatatggtactcctggcgccaccagatgttagctctcgccggcgccggtttcagagctatagctcctg |
35680108 |
T |
 |
| Q |
209 |
attatagaggctacggactatccgactcgccacctgaaccggaaaagaccaccttcactcatcttctcaacgaccttctgcaaattcttgatgctcttgc |
308 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
35680109 |
attatagagggtacggactatccgactcgccacctgaaccggaaaagaccaccttcactcatcttctcaacgaccttctgcaaattattgatgctctagc |
35680208 |
T |
 |
| Q |
309 |
tatttctaaggtacaca |
325 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35680209 |
tatttctaaggtacaca |
35680225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 98 - 324
Target Start/End: Original strand, 35663515 - 35663741
Alignment:
| Q |
98 |
tttcaggtccaaacgtggtcgtattcctccacggtttcccagagatatggtactcctggcgccaccagatgttagctctcgccggtgccggtttcagagc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
35663515 |
tttcaggtccaaacgtggtcgtattcctccacggtttcccggagatatggtactcctggcgccaccagatgatagccgtcgccggtgccggtttcagagc |
35663614 |
T |
 |
| Q |
198 |
tatagctcctgattatagaggctacggactatccgactcgccacctgaaccggaaaagaccaccttcactcatcttctcaacgaccttctgcaaattctt |
297 |
Q |
| |
|
||| ||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
35663615 |
tattgcttttgattacagaggatacggactatccgactcgccacctgaaccggaaaagaccaccttcactcatcttctcaatgacctccttgcaattctt |
35663714 |
T |
 |
| Q |
298 |
gatgctcttgctatttctaaggtacac |
324 |
Q |
| |
|
||||||||| || |||| ||||||||| |
|
|
| T |
35663715 |
gatgctctttctctttccaaggtacac |
35663741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 324 - 380
Target Start/End: Original strand, 35680248 - 35680304
Alignment:
| Q |
324 |
caactttgttagttagtaacgtgttaaaatgtctttcagtttttcttaagttaaact |
380 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
35680248 |
caactttgttagttagtaacgtgttgaaatgtctttcggtttttcttaagttaaact |
35680304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University