View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8517_high_1 (Length: 574)
Name: NF8517_high_1
Description: NF8517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8517_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 3e-77; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 310 - 513
Target Start/End: Complemental strand, 8000851 - 8000649
Alignment:
| Q |
310 |
ggtacaaactgacattggatttttggaattagatggaaaacnnnnnnngtagatcgtgtacaaataatcagaaaacatgctaccgttgataatcaaatct |
409 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8000851 |
ggtacaaactgacattggatttttagaattagatggataactttttttgtagatcgtgtacaaataatcagaaaacatgctaccgttgataatcgaatct |
8000752 |
T |
|
| Q |
410 |
tattttccttgctagctttgttaaggtgatttaaaggtcaattatttcttttattgaacaaatttgaaggtcaattattatattccccgatatgatgtca |
509 |
Q |
| |
|
||||||| ||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8000751 |
tattttcattgctagttttgttaaggtaattt-aaggtcaattatttcttttattgaacaaatttgaaggtcaattattatattctccgatatgatgtca |
8000653 |
T |
|
| Q |
510 |
acac |
513 |
Q |
| |
|
|||| |
|
|
| T |
8000652 |
acac |
8000649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 8001113 - 8000987
Alignment:
| Q |
1 |
atataatgcctacaatatgatgaatattgcaggtaaatacagccaagaaacgattggacaagtgggaaaactagaagaaaattcaggtccagtgctaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8001113 |
atataatgcctacaatatgatgaatattgcaggtaaatacagccaagaaacgattggacaagtgggaaaactagaagaaaattcaggtcc---------- |
8001024 |
T |
|
| Q |
101 |
ttggtgccagcgacgaggtgtgggggcaagtgacccac |
138 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8001023 |
-tggtgccagggacgaggtgtgggggcaagtgacccac |
8000987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 522 - 557
Target Start/End: Complemental strand, 8000620 - 8000585
Alignment:
| Q |
522 |
ttgatggcaaatggaagataacgatatatatgtagt |
557 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8000620 |
ttgatggcaaatggaagataacgatatatatgtagt |
8000585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University