View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8517_low_6 (Length: 377)
Name: NF8517_low_6
Description: NF8517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8517_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 18 - 360
Target Start/End: Complemental strand, 8376042 - 8375700
Alignment:
| Q |
18 |
cctatgaatgacttccagacttttgttcccattgtcagaatctcggtcatgatgttacggtttgccattagttgtaccctcagaaagaaagaaccgtatc |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8376042 |
cctacgaatgacttccagacttttgttcccattgtcagaatctcggtcatgatgttacggtttgccattagttgtaccctcagaaagaaagaaccgtatc |
8375943 |
T |
 |
| Q |
118 |
taaggaaaatgctataaagggcaagaagcaaataccaactagtaagctagatttggtgcctattaaaggaaattcttctggtgttggttcttctaatgca |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8375942 |
taagaaaaatgctataaagggcaagaagcaaataccaactagtaagctagatttggtgcctattaaagaaaattcttttggtgttggttcttctaatgca |
8375843 |
T |
 |
| Q |
218 |
tttgaagctattgattcagcaactgcaacaaaagaagaacatattgttgaatcacttgttgctacccgtaatgtcccggtcgcacaaaacagtcctgagt |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
8375842 |
tttgaagctattgattcggcaactgcaacaaaagaagagcatattgttgaatcacttgttgctacccctaatgtcacggtcgcacaaaacagtcccgagt |
8375743 |
T |
 |
| Q |
318 |
tgcaagcaatatagacgccggttgcaagtacttttgcagcaag |
360 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8375742 |
tgcaagcaatatagacaccggttgcaagtacttttgcagcaag |
8375700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 151
Target Start/End: Complemental strand, 18145664 - 18145631
Alignment:
| Q |
118 |
taaggaaaatgctataaagggcaagaagcaaata |
151 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
18145664 |
taaggaaaatgttataaagggcaagaagcaaata |
18145631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 23016037 - 23016073
Alignment:
| Q |
20 |
tatgaatgacttccagacttttgttcccattgtcaga |
56 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
23016037 |
tatgaatgacttccagacttttgttcacattgccaga |
23016073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University