View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_high_29 (Length: 280)
Name: NF8518A_high_29
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 20 - 172
Target Start/End: Original strand, 3990933 - 3991085
Alignment:
| Q |
20 |
tttggagttcaaggtagtatctctgttttttctcttgcattggatgactatctgcaaactaatattcttctttacttagtttcaacttaaggaaggaccg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990933 |
tttggagttcaaggtagtatctctgttttttctcttgcattggatgactatctgcaaactaatattcttctttacttagtttcaacttaaggaaggaccg |
3991032 |
T |
|
| Q |
120 |
aaacatatcccccattatggccttctcttagcagaagttgcaggattaccaac |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3991033 |
aaacatatcccccattatggccttctcttagcagaagtggcaggattaccaac |
3991085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 17936062 - 17935987
Alignment:
| Q |
98 |
gtttcaacttaaggaaggaccgaaacatatcccccattatggccttctcttagcagaagttgcaggattaccaact |
173 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
17936062 |
gtttcaacttaaggagtgaccgaaacatagcccccattatggccttctcttcgcataagtgaaaggattaccaact |
17935987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University