View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8518A_low_131 (Length: 305)

Name: NF8518A_low_131
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8518A_low_131
NF8518A_low_131
[»] chr5 (1 HSPs)
chr5 (20-172)||(3990933-3991085)
[»] chr1 (1 HSPs)
chr1 (98-173)||(17935987-17936062)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 20 - 172
Target Start/End: Original strand, 3990933 - 3991085
Alignment:
20 tttggagttcaaggtagtatctctgttttttctcttgcattggatgactatctgcaaactaatattcttctttacttagtttcaacttaaggaaggaccg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3990933 tttggagttcaaggtagtatctctgttttttctcttgcattggatgactatctgcaaactaatattcttctttacttagtttcaacttaaggaaggaccg 3991032  T
120 aaacatatcccccattatggccttctcttagcagaagttgcaggattaccaac 172  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||    
3991033 aaacatatcccccattatggccttctcttagcagaagtggcaggattaccaac 3991085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 17936062 - 17935987
Alignment:
98 gtttcaacttaaggaaggaccgaaacatatcccccattatggccttctcttagcagaagttgcaggattaccaact 173  Q
    |||||||||||||||  |||||||||||| ||||||||||||||||||||| ||| ||||   |||||||||||||    
17936062 gtttcaacttaaggagtgaccgaaacatagcccccattatggccttctcttcgcataagtgaaaggattaccaact 17935987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University