View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_132 (Length: 302)
Name: NF8518A_low_132
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_132 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 12253615 - 12253801
Alignment:
| Q |
21 |
aaagcaaagacaatattattagtaatttagtaaataaaatcataccacaaaacaaaagcaagcgccaagtaacccatgagcacttagattagatgataaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| | |
|
|
| T |
12253615 |
aaagcaaagacaatattattagtaatttagtaaataaaatcataccacaaaacaaaagcaagcgctaagcaacccatgagcacttagattagatgataca |
12253714 |
T |
|
| Q |
121 |
tgtcttctagcttaaacaaagtatgtggtcttaagagagcttgtcgctcatttaagttctacaaggctcgtgagattagtcttcaca |
207 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||||||||| |||| |||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
12253715 |
tgtcttctagcttaaccaaagtctgtagtcttaagagagtttgttgctcatttaagttccacaaggctcgtgagattagtctccaca |
12253801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University