View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_15 (Length: 476)
Name: NF8518A_low_15
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 6 - 343
Target Start/End: Original strand, 3990748 - 3991085
Alignment:
| Q |
6 |
tgcaagagttttccccatcaaacaaacatgtttatatattggacgatcatgtcttctgagccatgtttttaatcttccttcaggtatacgatatttgcca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990748 |
tgcaagagttttccccatcaaacaaacatgtttatatattggacaatcatgtcttctgagccatgtttttaatcttccttcaggtatacgatatttgcca |
3990847 |
T |
|
| Q |
106 |
ctcatatggagaatatagcggaattagcaacaatctatcccaacgtgaaaattctccactttcatgtcgaattaaaaaacaaccatttggagttcaaggt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990848 |
ctcatatggagaatatagcggaattagcaacaatctatcccaacgtgaaaattctccactttcatgtcgaattaaaaaacaaccatttggagttcaaggt |
3990947 |
T |
|
| Q |
206 |
agtatctctgttttttctcttgcattggatgactatctgcaaactaatattcttctttacttagtttcaacttaaggaaggaccgaaacatatcccccat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990948 |
agtatctctgttttttctcttgcattggatgactatctgcaaactaatattcttctttacttagtttcaacttaaggaaggaccgaaacatatcccccat |
3991047 |
T |
|
| Q |
306 |
tatggccttctcttagcagaagttgcaggattaccaac |
343 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3991048 |
tatggccttctcttagcagaagtggcaggattaccaac |
3991085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 269 - 344
Target Start/End: Complemental strand, 17936062 - 17935987
Alignment:
| Q |
269 |
gtttcaacttaaggaaggaccgaaacatatcccccattatggccttctcttagcagaagttgcaggattaccaact |
344 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
17936062 |
gtttcaacttaaggagtgaccgaaacatagcccccattatggccttctcttcgcataagtgaaaggattaccaact |
17935987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University