View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_183 (Length: 263)
Name: NF8518A_low_183
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_183 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 238
Target Start/End: Original strand, 32103473 - 32103698
Alignment:
| Q |
13 |
aatatatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103473 |
aatatatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcac |
32103572 |
T |
 |
| Q |
113 |
cgcggcctgcaacatgttttgaagcttactgcctaatggagatggagccgccattctttattcattcagtcattaccaaacagttttttctttcatttct |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103573 |
cgcagcctgcaacatgttttgaagcttactgcctaatggagatggagcagccattctttattcattcagtcattaccaaacagttttttctttcatttct |
32103672 |
T |
 |
| Q |
213 |
ctgcaatatttaatcatatctaaaac |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32103673 |
ctgcaatatttaatcatatctaaaac |
32103698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University