View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_202 (Length: 255)
Name: NF8518A_low_202
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_202 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 6307200 - 6307429
Alignment:
| Q |
18 |
aatatctaaccgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatattttcaaacccccgtgcacatctt |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6307200 |
aatatctaactgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatactttcaaacccccgtgcacatctt |
6307299 |
T |
|
| Q |
118 |
tcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgtactttgtggtggaatcatttggtcgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307300 |
tcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgtactttgtggtggaatcatttggtcgg |
6307399 |
T |
|
| Q |
218 |
acataattggactctcatcaaaagcaaata |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
6307400 |
acataattggactctcatcaaaagtaaata |
6307429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University