View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_209 (Length: 252)
Name: NF8518A_low_209
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_209 |
 | |
|
| [»] scaffold0019 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 8 - 136
Target Start/End: Original strand, 23521888 - 23522016
Alignment:
| Q |
8 |
ttggtgttggaggaggaattttagggcgtgggagcaggaacttttagtagagtgccaattgttgcttcttgatgtgtctttgcaggatgtttcttcagat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23521888 |
ttggtgttggaggaggaattttagggcgtgggagcaggaacttttagtagagtgccaattgttgcttcttgatgtgtctttgcaggatgtttcttcagat |
23521987 |
T |
|
| Q |
108 |
agttggatttggtcttccggatcttgttg |
136 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
23521988 |
agttggatttagtcttccggatcttgttg |
23522016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 131 - 177
Target Start/End: Complemental strand, 23518950 - 23518904
Alignment:
| Q |
131 |
ttgttgacacttttttctttccctctaaggaactaattattaatata |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23518950 |
ttgttgacacttttttctttccctctaaggaactaattattaatata |
23518904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 93
Target Start/End: Original strand, 49500 - 49585
Alignment:
| Q |
8 |
ttggtgttggaggaggaattttagggcgtgggagcaggaacttttagtagagtgccaattgttgcttcttgatgtgtctttgcagg |
93 |
Q |
| |
|
|||| |||||||||||| ||| |||| |||||| | ||||||||||||||||| | |||||| ||| ||||||| ||||||||| |
|
|
| T |
49500 |
ttggcgttggaggaggagtttgggggcatgggaggaagaacttttagtagagtgttagttgttgtttcgtgatgtgactttgcagg |
49585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 95
Target Start/End: Original strand, 17783659 - 17783739
Alignment:
| Q |
15 |
tggaggaggaattttagggcgtgggagcaggaacttttagtagagtgccaattgttgcttcttgatgtgtctttgcaggat |
95 |
Q |
| |
|
|||||||||| ||| ||| |||||| | |||| |||||||| ||||| || || |||||| ||||||| ||||||||||| |
|
|
| T |
17783659 |
tggaggaggagtttgaggacgtggggggaggaccttttagttgagtgtcagttcctgcttcatgatgtgcctttgcaggat |
17783739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University