View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_218 (Length: 250)
Name: NF8518A_low_218
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_218 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 12253341 - 12253099
Alignment:
| Q |
1 |
attccttcttgccctttttccaaggaatcaaccaatgactactaaggtttaggtattaaagggttttaggaagaaggtctatgctccgttgaggttgcaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12253341 |
attccttcttgcccttcttccaaggaatcaaccaatgactactaaggtttaggtattaaagggtttcaggaagaaggtctatgctccgttgaggttgcaa |
12253242 |
T |
 |
| Q |
101 |
aaatggggaaagaaggagatgtatgggataattcagttctcatcaatgcctctgacaacactatctttcttacaaggtatcttccattctcttcgcaatc |
200 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12253241 |
gaatggggaaagcaggagaggtatgggataattcagttctcatcaatgcctctgataacactatctttcttacaaggtatcttccattctcttcgcaatc |
12253142 |
T |
 |
| Q |
201 |
tcacttttcctgttctttcctttaatcgtgttgttctatgatt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
12253141 |
tcacttttcctgttctttcctttaatcgtgctgttctttgatt |
12253099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 75 - 230
Target Start/End: Complemental strand, 12245696 - 12245553
Alignment:
| Q |
75 |
aggtctatgctccgttgaggttgcaaaaatggggaaagaaggagatgtatgggataattcagttctcatcaatgcctctgacaacactatct-ttcttac |
173 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||| ||||||| ||||||||| ||| |||||||| |||| ||||||| |
|
|
| T |
12245696 |
aggtctatgctctgttgaggttgcaaaaat-gggaaagaagaagatgta--------------tctcatcaacaccttcgacaacaccatctcttcttac |
12245612 |
T |
 |
| Q |
174 |
aaggtatcttccattctcttcgcaatctcac--ttttcctgttctttcctttaatcgtg |
230 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
12245611 |
aaggcatcttccattttcttcacaatctcactttttttctgttcattcctttaatcgtg |
12245553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University