View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_248 (Length: 246)
Name: NF8518A_low_248
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_248 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 30197987 - 30198196
Alignment:
| Q |
17 |
agtactgttcaattaacatgatccaaatctaggttggttaaacacaatatcttagaacatggatgattgtttcatttgtatttcgacaaggagaacaagt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30197987 |
agtactgttcaattaacatgatccaaatctaggttggttaaacacaatatcttagaacatggatgattgtttcatttgtatttcgacaaggagaacaggt |
30198086 |
T |
|
| Q |
117 |
gagtaaaacttcaagtcctcatctacttctatgataattagcaagcagccactcatgagcaacaatcaacatgaaagtttggattatgtgaggactcttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||| ||||||||| || |
|
|
| T |
30198087 |
gagtaaaacttcaagtcctcatctacttctatgataattagtaaccagccactcatgagcaacaaacaacatgaaagtttggattatatgaggactcctt |
30198186 |
T |
|
| Q |
217 |
caaatcaaca |
226 |
Q |
| |
|
||| |||||| |
|
|
| T |
30198187 |
caactcaaca |
30198196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 11142148 - 11142105
Alignment:
| Q |
176 |
caacaatcaacatgaaagtttggattatgtgaggactctttcaa |
219 |
Q |
| |
|
|||||||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
11142148 |
caacaatccacatgaatgtttggattttgtgaggactctttcaa |
11142105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University