View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_254 (Length: 244)
Name: NF8518A_low_254
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_254 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 19506528 - 19506319
Alignment:
| Q |
20 |
cagtagtctctgagactctcatatctcactggattcccaacagatgaacccacatgatatatgctatcatcacaaggttgatttgcatgacttaccatgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506528 |
cagtagtctctgagactctcatatctcactggattcccaacagatgaacctacgtgatatatgctatcatcacaaggttgatttgcatgacttaccatgg |
19506429 |
T |
 |
| Q |
120 |
ccactagcattgcattcaccaccatatccgcagggatctgcttcaaattaacacaagcataagtataaatcaattttgtctaggcctaattatacattta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506428 |
ccactagcattgcattcaccaccatatcagcagggatctgcttcaaattaacacaagcataagtataaatcaattttgtctaggcctaattatacattta |
19506329 |
T |
 |
| Q |
220 |
gttatgttat |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
19506328 |
gttatgttat |
19506319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 36194208 - 36194326
Alignment:
| Q |
41 |
tatctcactggattcccaacagatgaacccacatgatatatgctatcatcacaaggttgatttgcatgacttaccatggccactagcattgcattcacca |
140 |
Q |
| |
|
||||||| ||| || | |||||| |||||||||||||||| | |||| | |||||||||||||||| ||||| ||||||| ||||||||| |||| |
|
|
| T |
36194208 |
tatctcaatgggtttctaacagaggaacccacatgatataccc---catctctaggttgatttgcatgagccaccatagccactaacattgcattgacca |
36194304 |
T |
 |
| Q |
141 |
ccatatccgcagggatctgctt |
162 |
Q |
| |
|
|||| || || || |||||||| |
|
|
| T |
36194305 |
ccatgtcagctggtatctgctt |
36194326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University