View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_260 (Length: 243)
Name: NF8518A_low_260
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_260 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 30334027 - 30334249
Alignment:
| Q |
1 |
ttaatctatttcccttgatgggttttgaattttattgttggaatcagctaattcaattgggaactgggttgtgacataacattcttttcagacatggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30334027 |
ttaatctatttcccttgatgggttttgaattttattgttggaatcagctaattcaattgggaactgggttgtgacataacattcttttcagacatggttt |
30334126 |
T |
 |
| Q |
101 |
gtttggggtttgatatggttgaggttgaagctcaaaggttggaactttgtttggttaagaggaaggaagttggtcttttgttgaggaccgtgtttggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30334127 |
gtttggggtttgatatggttgaggttgaagctcaaaggttggaactttgtttggttaagaggaaggaagttggtcttttgttgaggactgtgtttggttt |
30334226 |
T |
 |
| Q |
201 |
gttggtgtttctgctgtttctta |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30334227 |
gttggtgtttctgctgtttctta |
30334249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University