View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_271 (Length: 242)
Name: NF8518A_low_271
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_271 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 33026416 - 33026194
Alignment:
| Q |
20 |
ttcttaccttcggtgtgtcaatctcgaacacaggtctcttctgattcacaatcttttgattctcaaactgtttttgcatgacagatggaaatgttcttga |
119 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33026416 |
ttcttaacttcggtgtgtcaatctcgaacacaggtctcttctgattcacaatcttttgattctcagactgtttttgcatgacagatggaaatgttcttga |
33026317 |
T |
|
| Q |
120 |
aggggattgttctaatcccatcaactttgcaacaagattggtacttttttccttccttggaaaagtcggtgaacacgaagaatcagaaagtttgtcatac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026316 |
aggggattgttctaatcccatcaactttgcaacaagattggtacttttttccttccttggaaaagtcggtgaacacgaagaatcagaaagtttgtcatac |
33026217 |
T |
|
| Q |
220 |
caaacaacagatgattggcttga |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33026216 |
caaacaacagatgattggcttga |
33026194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University