View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_284 (Length: 238)
Name: NF8518A_low_284
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_284 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 37195389 - 37195595
Alignment:
| Q |
19 |
tttctgatctaaatctaacaaacgtcgatacactgaaaacaagatatcccaacagcaggaggcagtatctttaataccagtcgtatcaggtcgtatcaac |
118 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37195389 |
tttctgatataagtctaacaaacgtcgatacactgaaaacaagatatcccaacagcaggaggcagtatctttaataccagtcg----------tatcaac |
37195478 |
T |
|
| Q |
119 |
attaagcatagtcatatgctaacttttatttcattttttgacaaaatatgctcactcacttttatgtatcttcagttattcaccatcaagaagaaaaaga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37195479 |
attaagcatagtcatatgctaacttttatttcattttttgacaaaatatgctcactcacttttatgtatcttcagttattcaccatc---aagaaaaaga |
37195575 |
T |
|
| Q |
219 |
tggctaactagtcactacaa |
238 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
37195576 |
tggctaactagtaactacaa |
37195595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University