View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8518A_low_304 (Length: 232)
Name: NF8518A_low_304
Description: NF8518A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8518A_low_304 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 43710181 - 43709986
Alignment:
| Q |
20 |
aagaataacccaaaatttgatcgatcgagagagaatatgcaacgtcttgctgataatgtcatcgctgttactaaagagtaagcacatttctatgcttcca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43710181 |
aagaataacccaaaatttgatcgatcgagagagaatatgcaacgtcttgctgataatgtcatcgctgttactaaagagtaagcacatttctctgcttcca |
43710082 |
T |
|
| Q |
120 |
aattcatttcttgcatgtgtacatttattatgtagttctattgaatttatgtcannnnnnnctttcatttctaggaatttacttcggttattttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43710081 |
aattcatttcttgcatgtgtacatttattatgtagttctattgaatttatgtcatttttttctttcatttctaggaatttacttcggttattttct |
43709986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University